>に続いて、班名+サンプル名が表示されています。

 

[サンプル名]

E: Escherichia coli 染色体 DNA 断片

G: GFP 断片

>1E
NNNNNNNNNNNCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGNTCCTCG
AGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGT
TCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTG
CCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA
GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACA
AGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGAC
GGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGG
CATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCC
CCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAG
AAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTAAGG
ATCCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGN
CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGG
GCAAGCTGCCCGTGCCNNNNCCACCCTCGTGANCNCCNTTCACCTACNGNGNGCANTGCTTCAGCCGNNTACCCCNNANC
NNNATGNAAGCNAGCNNGANNNCNTNNANGNNCNNNNNNNNNNANNNNACNTCCANGNNNNGNNNCNNNNNNNNNTNNAN
NNNNNANNNGGNNNNNNNNNCANNNNAANNCN

>1G
NNNNNNNNNNNNNNNCCCTCNCTAAAAGGGACAAAAGCTGGAGCTCCACCGCNNNGGCGGCCGCTCTAGAACTAGTGGNN
NNTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCA
CAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA
AGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATG
AAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAA
CTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGG
AGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAG
AACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAA
CACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCA
ACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAG
TAAGGATCCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAA
ACGGNCACAAGTTNCAGCGTGTCCGGCGAGGGCGAGGGCGATGTCCACCTACGGGCAAGCTGAACCCTGAAGNTCATCTG
CACCACCGGCNAAGCTGNNNNGCCCCTGNNNCCNNCCTCGTGACCACCNTTCNNCNNACNGGNGTGCANNGGCTTCAGCC
NNCNTACCNCNNNNNNATGAANGCNANCNACGGANNNNCNNNNAGTNNNNNNNNNGNNCCCGNAANGNNNNNNNNNNNNN
NNNNNNNNNNNNTNNNTNNNNGGNANCNNANNGGNNNNCNNNNNNNNNNNNNC

>2E
NNNNNNNNNTNNNNCNTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGNTCC
CCCGGGCTGCAGGAATTCGATATCAAGCTTCGGCTTCGGTGTAGTATTGGTTATCGAGTTTACGCTGAATATTACTTTTA
TATGCAAGACCAAATTTACCGATACTTGTCTCATCATTATGCACAGCACAACCAGACATAATAAAAATACTAATTAATGA
TATAGCAGCTATCTTTTTCATCTCACCTTCCCCCATTAAATACCAACGACACTCTCTAGTGTTTAAATATAATAATGGCA
TGATTATTATAATTGAATAGGATTATAATAAATGTTCTGTACAACATTTCCTACATAAGTAGGAATTACGGACATTGAGG
CCCTTCAGGGTAACTCCATGGGGGCTTTAATATATTATATTGAAGATGCCACTGTTTAGTTGAATATTAGGTATATGCTC
TTTTTTGAAATTTATCGGTGGCAGCCGTTAGTATTCGCTGTCCCCATTGCAAGCTCCTGGTGGTAACCACTGAATCCTCC
ATACTTGAACTGACTTTTTATCCTCCGACTTTCATCCTGTTCTGACTCCACCTTTTGTTTTCTGCTCTACACTATCTACA
GACCAATCATAAAGGCACATACGATCATGGCAGAATTTCCCGCCAGCTTACTGATTCTTAATGGCAAAAGTACTGACAAT
CTACCCTTGCGCGAAGCAATTATGCTGTTGCGTGAGGAAGGAATGACGATCCATGTGCGGGTCACCTGGGAGAAAGGCGA
TGCCGCACGATATGTAGAGGAGGCCCGGAAGTTTGGCGTCGCAACGGTGATTGCCGGTGGTGGCGATGGCACCATTAATG
AAGTTTCTACGGCGTTGATTCAGTGTGAGGGGGATGACATACCCGCGCTGGGGAATTTTGCCATTAGGAACCGNCCAATG
ATTTTGCCACCAGTGTAGGGATTCCTGAGGCACTGGNNAANNNGCTGAAACTGGNNANTTGNCGGTGACGCCATTGCGAT
AGATATGGNCGCNNNNANNAACAAACCTNNTTTATTNNNTNNNNCNGNNNNTGNNNGCGNNATNCNNNNAAANNNNNNAA
ATNNNNNNNNGNNNNNNNNNNNNNNNCNNGNNNNNNNAAANN

>2G
NNNNNNNNNANNNNNNNNNNCNCTAANGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGN
TCCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCC
ACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGC
AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACAT
GAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCA
ACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG
GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAA
GAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGA
ACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCC
AACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAA
GTAAGGATCCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTA
AACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCAC
CACCGGGCAAGCTGCCCGTGCCCTNNNCACCCTCGTGACCACCTTCNCCNACGGNGNGCAGTNGCTTCNNCCNGCTACCN
NCGACNACATNANNCAGCACNNANNTNCNTNNNGNNCCNNCNNNNNNNNNNTNACGNNCANGNNNNNNNNNNNNNTTCAN
NNNNANNGGNNAACTNNNNANNANANNCNGNNNN

>3E
NNNNNNNAANTNNNNCCTTNNCNTAAAGGGAAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGNNN
NNNCCCCGGGCTGCAGGAATTCGATATCAAGCTTGCAGTGATGATGTTTCACTACCCACTGCACGTGTCTCAGGATGCAT
ATTCTTTGCGGTGTTATTTGCACTACATGCAGAAAGCAGAACCGCTACTGCAATCGCGGGAATCCCGCGCAAGATATATC
TCAAAATCGGTTGAGATTTGACCATGTTGTTTGTTTTCCCTTGAAGTCCTTAACGACAAATATCGTTATAAAAAAATGCC
AAGCGACACGAGACTAATTACCTGGGCATGTTGAAACAATTCCTTAAGGCCAAATCTGTGGACTAACGCACAAAATTATA
TGCTGTGAGGATAATCTACCGCCGAGGCAAAACGAGTTCGAGATTACCCGATTGGTGCGGTCTTGGCGAGCGGTTTTACA
TGATTTTTTATAAGAAAAAGTGATACAGAAAGTTAATAAGCGGGGTTGGTCAATTAAAGTACAATTGAGTGAAACGCATG
CAATCCATTCATTTACTTAGAGAATGATTTTTGCGTTCGATAGATGAAAGCACGGTGCGCATCATCAGGATTATCCTCAC
TATAAAAATAACCCTGATGATGTTAATTACTGTGAGTTATTTGTTTTGGAAATGTTTGTTTTTTCCTGGTAGTGATTTGT
CAAAAAAGGTGATTAATCGATCACTTAATGGCGTCAGCAACACCCAGGGCAAACCGATCAATATCACGGNCATCGAACCG
ACAATGATGTCAGTAAACCAGTGTGCGCCAATCATTACTCTGGGAAATGCAAAAACCACAAAAATAATAAGGGCGATAAG
GGCCTGCAACTTTGCCGAAATAACGCCACATGAATGCCGAAAAATAAGCAGCATCATGCCGTGATCGCCGGGAAAGCTAT
CTCGNGAGGCATCTTTCGNGGGAACAGAGAGCAGTTCGCTGACGCGGTTAATATCNNNNAAAAGTCAATGTTGGGNNNGN
CCCGTTTTACAGGAANTAATGNCNNNNNCCNNNNTNGGTNNNNCCCACNNNNNNNNTNNNNNNNATNNNCNGNNNNNNAN
NACNNNNNNCGTCNNNNNNNNNNNGGGNNTNNNNNTTTNNCNNNNNCCCNCNN

>3G
NNNNNNNNNNNNNNNCNCNNNNNTAAAGGGAACAAANGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTNGN
NCCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCC
ACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGC
AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACAT
GAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCA
ACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG
GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAA
GAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGA
ACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCC
AACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAA
GTAAGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGNACCCAA
TTCGCCCTATAGTGAGTCGTATTACAATTCACTGGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGNGTTACC
CAACTTAAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGNCGTAATAGCNAAGANNNCNGCACCGNNNNGCNNNCC
NANNNNNCGCANNNTNNNGNNGAATGGNNGCCGNCCNNNNAGCGGNGNNNTNAGNNNNNNNNNGNNNNACNNCNCANNNG
NNNNNNCNNNNNNNNNNNNN

>4E
NNNNN

>4G
NNNNN

>5E
NNNNNNNNNNNNNNNNNNCNNTNNNNGNNNNNAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGNNNC
CCCGGGCTGCAGGAATTCGATATCAAGCTTTCGACGAAATTGGCGCACGCCTTCAAAGCTATAGTGATCCCAATCAGGTT
GAATTCTATACTTCGGGCCGCACTTCCAATGAAGCTGCCTTTCTTTATCAGCTTTTTGCCCGTGAATACGGGAGCAATAA
CTTTCCCGACTGCTCCAACATGTGCCATGAACCGACAAGCGTGGGTTTGGCAGCGAGTATCGGTGTAGGTAAAGGGACCG
TGTTGCTGGAAGACTTTGAGAAGTGCGATTTAGTCATTTGCATTGGGCATAACCCTGGTACAAACCACCCTCGCATGCTG
ACTTCGTTGCGCGCTTTAGTGAAACGGGGAGCGAAAATGATCGCCATCAATCCTCTACAGGAACGTGGCCTGGAGCGATT
TACCGCACCGCAAAACCCGTTTGAAATGCTGACGAACTCTGAGACTCAGTTGGCCAGTGCCTACTATAACGTGCGCATTG
GTGGCGATATGGCGTTGCTCAAGGGGATGATGCGCCTGTTAATTGAGCGCGATGATGCTGCAAGCGCCGCAGGTCGGCCT
TCATTGCTTGATGACGAGTTTATTCAAACGCATACCGTCGGCTTTGACGAGCTACGCCGTGACGTTCTCAATTCCGAGTG
GAAAGATATCGAACGTATTTCTGGACTAAGTCAGACACAAATCGCCGAACTGGCTGACGCATATGCCGCTGCCGAACGCA
CCATTATCTGTTACGGAATGGGGATCACTCAGCACGAACATGGTACCCAGAACGTACAGCAACTGGTCAATCTGCTGTTG
ATGAAAGGTAACATTGGCAAGCCTGGGTGCGGGTATCTGCCCACTACGTGGNCACTCTAATGTACAGGGCGACCGAANCG
TCGGTATCACCGAGAAACCGTCTGCANANTTTCTGGCTCGTCTGGGNNANCGCTATGGNCTTTCACCCCCACCTCATGCN
NCNNGNNCATGGCTGCATNGNCNAGCATGNCAANNNANTATNNACGGGGNAGGNNNNGANCANTNNANNTNNANGGGGGG
NNNNNNGCNCNNNGNNANNNNNNNNATNNNGNNNNNNCNNNNN

>5G
NNNNN

>6E
NNNNNNNNNANTNNNCTCNCTNNNGGNNNNNNAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGNNNC
CCCGGGCTGCAGGAATTCGATATCAAGCTTTCGACGAAATTGGCGCACGCCTTCAAAGCTATAGTGATCCCAATCAGGTT
GAATTCTATACTTCGGGCCGCACTTCCAATGAAGCTGCCTTTCTTTATCAGCTTTTTGCCCGTGAATACGGGAGCAATAA
CTTTCCCGACTGCTCCAACATGTGCCATGAACCGACAAGCGTGGGTTTGGCAGCGAGTATCGGTGTAGGTAAAGGGACCG
TGTTGCTGGAAGACTTTGAGAAGTGCGATTTAGTCATTTGCATTGGGCATAACCCTGGTACAAACCACCCTCGCATGCTG
ACTTCGTTGCGCGCTTTAGTGAAACGGGGAGCGAAAATGATCGCCATCAATCCTCTACAGGAACGTGGCCTGGAGCGATT
TACCGCACCGCAAAACCCGTTTGAAATGCTGACGAACTCTGAGACTCAGTTGGCCAGTGCCTACTATAACGTGCGCATTG
GTGGCGATATGGCGTTGCTCAAGGGGATGATGCGCCTGTTAATTGAGCGCGATGATGCTGCAAGCGCCGCAGGTCGGCCT
TCATTGCTTGATGACGAGTTTATTCAAACGCATACCGTCGGCTTTGACGAGCTACGCCGTGACGTTCTCAATTCCGAGTG
GAAAGATATCGAACGTATTTCTGGACTAAGTCAGACACAAATCGCCGAACTGGCTGACGCATATGCCGCTGCCGAACGCA
CCATTATCTGTTACGGAATGGGGGATCACTCAGCACGAACATGGTACCCAGAACGTACAGCAACTGGTCAATCTGCTGTT
GATGAAAGGTAACATTGGCAAGCCTGGNGCGGGTATCTGCCCACTACGTGGNCACTCTAATGTACAGGGNGACCGAACCC
GTCGGTATCACCGAGAAACCGTCTGCAGAGTTTCTGGCTCGTCTGGGNTGAGCGCTAATGGNTTCACCCCANCTCANGCA
CCNNGNNNATGCTGCNATNNCNAGCATGNNANNAANTNTNNTACGGNNNNGGNNNNNANCATNNNNTGNNNNNNNNNNNN
NNTNNNNNNNCNGANNNNNGNGGNNNNNNNNN

>6G
NNNNN

>7E
NNNNNNNNNNNNNACCCCNTCNNTAAAGGGAACAANAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTANCGGN
TCCCCCGGGCTGCAGGAATTCGATATCAAGCTTTCCACGCAGGCATTATCGTAGCAGCAACCTTTTGCGCTCATACTTCC
ACGCAGATTATGCCGCTTCAGTTGCGCCTGATAATCTGCTGAACAGTACTGGCCTCCACGGTCCGTGTGAACGATAACGT
TCCGGGGCCTCTTACGCCGCCACAGCGCCATCTGCAGGGCATCGCAGGCCAGTTGCGCCGTCATGCGTGGCGACATTGAC
CAGCCAATAACGGCACGTGACCACAGGTCAATGACCACTGCCAGATACAGCCAGCCTTCATCTGTACGTAAGTACGTGAT
GTCTCCTGCCCACTTCTGGTTCGGGCCACTGGCGTAAAAATCCTGCTCCAACAGATTTTCTGACACAGGCAGGCCGTGTG
CGCGGTAGCTGACCGGGCTGAACTTCCGGGAGGCCTTTGCCCTCAGTCCCTGACGGCGCAGGCTTGCCGCCACGGTTTTT
ACGTTAAAGGGGTAACCCTGAGCACGCAGTTCATCCGTCAGGCGTGGGGCACCGTAACGCTGTTTTGACCGGGTAAAAGC
CGCGAGGACAACGCTGTCGCAGTGTTGGCGGAACTGCTGACGCGTGCTTATCCTTGTCCGCCGCTGACACCACGTATACC
AGCCGCTGCGGGCCACCCGGAGCACGCGGCACATTGCTTTGATGCTGAACTCAGCCTGATGTTTTTCAATAAAGACATAC
TTCATTTCANGNNNNTTCGCGAAGTATGTCGCGGCCTTTTGGAGGATAGCCAGCTCTTCATCCCGTTCTGCCAGCTGGCG
TTTGAGACGTGCAATCTCGGTAGACATCTCCAGTTCACGTTTCAGAAGACGTCTGCTGATTTTTGCTGTTTACTGCGNCC
AGTTGTAGAGTTGTGATTCATACAGGCTGAGTTCACGGGNTGCCGGCAGTAANNACCGANGCGNTNCAGCAAGCTTATCG
AANNCCCGTCNANCNTNNNNGGNGGNNCCCGGGNNCCCNANTTCGCCCCTNNNANNGNANNCNNNATNNNANNNNNNNNN
NNNNNNNNAACNNCNNGANNGNNAAAANCCNNGNNCGNNNTNCCCCNA

>7G
NNNNNNNNNNNNNNNNNCCNTTNNNNNNNGGNNNNNNAAGCTGGAGCTCCACCGCGGNGGCGGCCGCTCTAGAACTAGTN
NNTNCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG
CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCG
GCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCAC
ATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGG
CAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCA
AGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAG
AAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCA
GAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACC
CCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTAC
AAGTAAGGATCCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGGTCGAGCTGGACGGCGAC
GTAACGGCCACAAGTTCAGCGTGTCCGGCGAGGCGANGGCGATGCCNCCTACGGCAAGCTGACCCTGAAGTTCATCTGCA
NCANCGGGCAAGCTGCCCGNGNCCNNGGNCCACCCTTCGTGACNACCTTTCACCTTACGGCGNGCNNNGCTTCAGCCCNN
TTACCCCNNANCACATNNAAGCAGCANGACTTNCTTTCAANNNNCNNNNTNNCCNNANNNNTTACNNNNNNNGNNNNNNN
NNNNNNNNNTNNNAGGNNCNNNCNGNNNNNNACNNAGNNNCCCNGNNNNNNCNNN

>8E
NNNNNNNNANNNNACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGNNGNNC
CCCCGGGCTGCAGGAATTCGATATCAAGCTTGTTATTCATTGGTTAAGTAATAAATCTGGAAGTTTGTCTTTGTTTTGAG
GCTAATGAGTGGTTTTACATAACCGCCTCTATACGCTGTTGATGAATAGTTCTTATGAATAAAGATATCCAGTTCATACT
TTAAGTGAAAATTGATAAAGTGCGATTCGTATTGTCTTTTATTCTAAAGACATCGAGTGTAGTTAATATTCCTTGTAAAA
ACAGGGATAAACCGAACTAGTTAAAGTTTTTATTATGTTCCCTGCATCAGCGGGGATAAACCGGACTTGTTATCATTTTT
TAAGTTGTCGAACTTATGTTCCCCGCGTCAGCGGGGATAACCATTCAGGTATGTTCAGGCCGGGCAGTTTCCCGCCCGGC
CTTCCTCACTTACGCATTCGACCAGCTCTGGATCGAATCCACATTCCCCAATTCCCCATGCATCACTTCATACGATTTTT
TCAGGATCACATCAGTATGTTTGGTTAGGTCTTTGAAAATGCCTTTATTCATCGCGTCGTAGCGTTTGGCATTGCTCTCA
ATCGGTATAAAGATATCTTTCACGCGAACCATGTTATCGACAGCCGTTGCGTAATCCGGGTATAGCCCCAGACCTACCGC
TGTATTAATCGCTGCCCCCAGGCTTGCACAACCGTTAATGGCGTTACGTCGTGCCGGAAGGTTGAACACGTCGGCAAAAA
TCTGCATAAACAGATCGCTGTTCGAACCGCCGCCAGTAATGATCACATGCTTCGCAAAGTGATTCATTTCATTACACATA
TTGTCGTAATTGTTCTTCAGCGTCAGCGCCACGCTTTCCAGTATCGAACGATATATCCATGCGNTAATCCATGCTGGAAT
CAAAGNCCGATCATAATCCCGCGTTTGNACNGTNCCCACGGNATTGGNCANCNAGTCCNNNCACCGTCCATCAGACNATT
ACAGNCTNNNGCNCACAGANCTTNANNNGNTACCNGTCGNNCNTCNAGGGGGGGGNNGGNANCCANNNNNNNNNNNGNNN
NCNNNTANNNNNNCNNNNCNNNNNNNNNTTNNNNNNNNNNNNNNNN

>8G
NNNNN

>9E
NNNNNNNNNNNNAANCNNNNNNNNTAAAGGGNNNNNNNNNCTGGGAGCTCCACNNNNNNGGCGGCCGCTCTAGAACTAGN
NNNNNNNCNNNGCTGCAGGAATTCGATATCAAGCTTCTNNNNNTGGNACTGCGACTTGCCTCCTGCGTCTCCGCAAACCT
GGGGCGAGCAAACTGACGTACCGGAATCTGCTGACTGGTACAACTCCAGCTACATCATCGCCTGGGGGTCAAACGTGCCG
CAGACGCGTACCCCGGATGCTCACTTCTTTACTGAAGTGCGTTACAAAGGGACCAAAACTGTTGCCGTCACACCAGACTA
CGCTGAAATCGCCAAACTGTGCGATCTGTGGCTGGCACCGAAACAGGGCACCGATGCGGCAATGGCGCTGGCGATGGGCC
ACGTAATGCTGCGTGAATTCCACCTCGACAACCCAAGCCAGTATTTCACCGACTATGTGCGTCGCTACACCGACATGCCG
ATGCTGGTGATGCTGGAAGAACGCGACGGTTACTACGCTGCAGGTCGTATGCTGCGCGCTGCTGATCTGGTTGATGCGCT
GGGCCAGGAAAACAATCCGGAATGGAAAACTGTCGCCTTTAATACCAATGGCGAAATGGTTGCGCCGAACGGTTCTATTG
GCTTCCGCTGGGGCGAGAAGGGCAAATGGAATCTTGAGCAGCGCGACGGCAAAACTGGCGAAGAAACCGAGCTGCAACTG
AGCCTGCTGGGTAGCCAGGGATGAGATCGCTGAGGTAGGCTTTCCCGTACTTTGGTGGNCGACGGCACGGAACACTTCAA
CAAAGTGGAACTGGAAAAACGTGCTGCTGCACAAACTGCCGGTNGAAAACGCCTGCAACTGGCTGATGGGCAGCACCGCC
CTGGTGACCCACCGTTTATGATCTGACGCTGGGCAAACTACGGGTCTGGAACGTTGGCCTGAACGACGTTAACTTGTGCA
ACCCAGCTATGAACGATGTGAAAGNNTATCGATACCGTCGACCTCGANGGGGGGGNNCCGGNNCCCCATTCGCCCCTTAT
AANNGGAGNCCNNATTACAATTNNNCTGNNNNGTCNNTTTTNNCNNNTNNNNGACCTGGGGAAAAAACCCNNGGNNNNTN
NNCCCAANNNNAANNNCNNCNTTNNNNNNNNNNNNNNCCCNNCNCCCTTTTNCNNNCCNNNNNNNNNNNNGGNNNNNNNN
NNAANNTANNNGNNNN

>9G
NNNNN

>10E
NNNNNNNANNNNCCNCACTAAAGGGAACAAAAGCTGGAGCTCCACCGNGGTGGCGGCCGCTCTAGAACTAGTNGNNCCCC
CGGGCTGCAGGAATTCGATATCAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTTTTGCCCG
TCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTTTCTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCT
TCATGGCGGCAGCAAGTTCAGAGGCAGGAACAACCTGTTCTCCGGCGGCGACAGCAGTAAGACTTCCTTCCTGGTATTGC
TTACGCCAGAGAAATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCATCCCCGGTTCAAAGCT
CTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGCGTTTCTCCGGCCCTAAGACATCAATCATCTGTTCTC
CAATGACTAGTCTAAAAACTAGTATTAAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGT
CTAAACCCCAGAACTTACTTATGCTGATTCCGGTGCGAAAATTGTTAATAAAGGTACTTGTAGATTCAATTGGTCAACGC
AACAGTTATGTGAAAACATGGGGTTGCGGAGGTTTTTTGAATGAGACGAACATTTACAGCAGAGGAAAAAGCCTCTGTTT
TTGAACTATGGAAGAACGGAACAGGCTTCAGTGAAATAGCGAATATCCTGGGTTCAAAACCCGGAACGATCTTCACTATG
TTAAGGGATACTGGCGGCATAAAACCCCATGAGCGTAAGCGGGCTGTAGCTCACCTGACACTGTCTGAGCGCGAGGAGAT
ACGAGCTGGTTTGTCAGCCAAAATGAGCATTCGTGCGATAGCTACTGCGCTGAATCGCAGTCCTTCGACGATCTCACGTG
AAGTTCAGCGTAATCGGGGCAGACGCTATTACAAGCTGTTGATGCTAATAACCCGANCCAACAGAATGGCGAAAAGGNCA
AAANNNGCTTACTGGNNCAAAANTTNNCNNTGCGAANNTNATCGATNCCGNNCGANNNNNNNGGGGNNCNNGNNCCCNNN
TNNNNCCCNNNNNNNNNGNNNNNNNNNNNNTTNNNN

>10G
NNNNNNNNNNNNNNNNCACTAANGGAACAAAAGCTGGAGCTCCACCGNNNTGGCGGCCGCTCTAGAACTAGCGNNTCCTC
GNGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAG
TTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCT
GCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGC
AGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTAC
AAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGA
CGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACG
GCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACC
CCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGA
GAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTAAG
GATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGTACCCAATTCGC
CCTATAGTGAGTCGTATTACAATTTCACTGGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAAN
CTTAAATCGCCTTGCAGCACATCCCCCTTTCGGCCAGCTGGNGTAATANCNNNNAGGNNNNACCGATCNNNTTNCCNANC
ANTNGCGCANNNGAATGGNNAATGGGNNGCNNNNNNAGCGGNNCATTNANNNNGCNGNNNNNNNNNNNCNNNNCAGCNNG
NNCNNCNNNNCNNNNNNNNNNNNNNNN

>11E
NNNNNNNNNNNANNNTGNTTANGGTGATGGTTCACGTAGTGGGCCATCGNCCTGATAGACGGTTTTTCGCCCTTNNNNGN
TGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGAT
TTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAA
AATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACA
TTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTC
AACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA
GTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAG
TTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACG
CCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCAT
CTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCT
GACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGG
AACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAA
CTATTAACTGGGCGAACTACNTNNCTCTAGCTTCCCGGGCAACAATTTAATNANACTGGATGGANGNNGGATAAANNNCN
NNACCNNTNCTGCGCTCGGNCCTTNCNGGCNNGNCNNNNNNTGNNTGANNANNNNNGNANCCNNNNNNGNGNNNNNGNNN
NCATTNNNGCNNNNNNGGGNNNCNNNNNAANNGGNNNNNN

>11G
NNNNNNNNNNNNANCNTCACTNNNGGGAACAAAAGCTGGAGCTCCACCGNGGTGGCGGCCGCTCTAGAACTAGNNGNNNC
TCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACA
AGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAG
CTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAA
GCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACT
ACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG
GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAA
CGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACA
CCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAAC
GAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTA
AGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGTACCCAATTC
GCCCTATAGTGAGTCGTATTACAATTCACTGGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGNGTTACCCAA
CTTAATCGCCTTNGCAGCACATCCCCCTTTCGCCAGCTGGNGTAATAGCNNANANGCCCNCACCGATCGCCCTTTCCCNN
CNNTNGCGCANNNNNNNNNNAANGGGNACGCGCCCNGTANCGNNCATTANNNCNNNNNNNNNNNNNCNCGCANNGNGACN
NCTTNNNNNNNNNNNNNNGGNNNNNN

>12E
NNNNNNNNNNNACCTCACTAAAGGGANCAAAAGCTGGAGCTCCACCGNGGTGGCGGCCGCTCTAGAACTANNGNNCCCCC
GGGCTGCAGGAATTCGATATCAAGCTTACCGACCCCGAGGGTAAAGATGATGAAGAAAACGGGTACCAGGTAACCGGCAA
TAAAGTCGTTTTCATAAGGTGTGCACAACAGAAGTAGCAGCACGCTTAACGCTGCCAGCCAGCTTAAGGTAAATGCGCGT
TTCTCTTTGCCCAACGACGGAGCGATATCCCTGCGCCACAATATCTGCGCAAAGTGGGGACTTACAATCATGCGAGTGAG
ATAGTAGAAAAGCATGTTGTAAATCAGCACAGCGGTGAAAAGGCTTAGCAAATCAACGACCGTGAAAATGGCATCCGCAT
CGCCGAAAAAGGTGGATATCTTTAGCGGGAAATCAAAGAAGCTCCCCACAAGATACATGCTGCATTTGATGCCGATCGGC
GTCACCAAACCAAGCCAGAACAGACGTTGCCAGACATATCGGCTGGTCAATCCATAACGCCAACGCGTCCCCAGCTGCCA
GCGTAATATTGCGCAGGCACACAACACGACAAACGTCTGGCTACCGAGCATGACCGCAGTCTGTAAAAAAGAGAGATGAA
AGTTCCACAGATTGGTGCAAAACATCCCGCATAAAACGGGAACGACACCGCGCCAGCCAAAGATAAACAAGATTGACAGC
ATTACGCACAGTGGCATCCACGCCAGAAAGATATAACTGGAATGGATAATGGCAAGTGGCGAAATAAAACGGGATAGCTG
AATAAGTACCACGGTGAGCGTAAACGCTAGTGTGAATATCTTGATATTTTTTATCAGGTTATGCTCCACAAACATGAGTA
CACTACTCTCACTGATCGGGGTTTTCAGGCACACAAATAATAAGTTTATTCGCATCGCGAAGCANCAGGGGGGNNANNNT
GTTGCCGATTTTTTCATCCCAATGATGCTTTCACCAGGGCGGGCACTNAACCCNGNACGTAGACTGNATTACAAAAGCNG
NNNAAAGCAGANNANAAAAAAANCCCCCGNNTTGCAGNNNNNGGNNNGNNNNNNNNGGNGNANCNNAANNGNNNCNNNCN
NNNNNNNNNTNNCANNNNNNNNNNNNNGGGNNNN

>12G
NNNNNNNNNNNNNNCACTAAAGGGANCAAAAGCTGGAGCTCCACCGNGGTGGCGGCCGCTCTAGAACTAGTGGNNCCTCG
AGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGT
TCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTG
CCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA
GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACA
AGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGAC
GGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGG
CATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCC
CCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAG
AAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTAAGG
ATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGTACCCAATTCGCC
CTATAGTGAGTCGTATTACAATTCACTGGNNGTCGTTTTACAACGTCNNGACTGGGAAAACCCTGGNGTTACCCNACTTA
AATCGCNTTGCAGCACATCCCCCTTTCGCNAGCTNGNGTANTAGCGAANANNNNCGNACCGATCNNNNTCCNNNNNNNNG
CANCNGAATGNNANGGGNANNNNNNCCNNNNAGCNNNGCATTNAGNNNNNNNNNNNNNNACGCGCANCGNGANNNNNNNC
ANNNNNNNNNNN

>13E
NNNNNNNNNNACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGANCCCC
CGGGCTGCAGGAATTCGATATCAAGCTTGCTCCACCAATGCGGCTGACCGCCCCCTGGAAGCACAGGCCCACTACATCAT
CGTGTAGACCGACCGCTTCAAACAGTTTCGAGCAGCGGTAAGAGGCGATGGTGGAGATGCCCATTTTGGACATGATTTTG
TACAAGCCTTTGTTGATGCCGTTACGGTAGTTGAGCATCACGGTACGATAATCTTTGGCAATCGCATGGGTGTCTACCAG
GCGGCCCAGCGTTTCATAGGCAAGGTATGGATAAATAGCCGTCGCGCCGAAGCCCAGCAACACGGCGAAGTGGTGCGGAT
CGCGGGCGCTGGCGGTTTCGACGATGATGTTGGCATCGCAACGCAGGCTTTGATCGACCAGACGGGTCTGGATCGCGCCA
ACCGCCATCGGGGCTGGAACCGGCAGGCGATCTTTAGCGATATTCCGGTCGGAGAGCACCAGCAGCACGGTGCCGCTACG
TACCATTTTTTCGGCTTTGTCGCACAGCTCTTTGACTGTCGCTTCGAGCGTGGTTTTAGTGACGTCAAAGGTGATATCCA
GCGTATCTGCGCGGTAGTGCTCCTCTTTCATCGTCGTGAGCTGTTTGAAATCGGAGTAGAGCAGAATCGGCGATTTAAAG
CTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCG
TCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGC
TGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCANCCTGAATGGNNAATGGGACGCGCCCTG
TAGCGGCGCATTAAGCGCGGNGGGNGTGGNGNNNACGCGCANCGNGACCGCTACACTTGCNGCGCCCTANCGNCCGCTNN
NNTCGCTTNCNTCNNNNTTCTCNNCNCNNNNNNNNNTTTCCCCGTCANNNNNNNNNNGGGNGNNNNNNNNNGNNNCNNNN
TNNNNNCTTTANC

>13G
NNNNNNNNNNNANTANNCNTCANTNAAGGGAACNNAAGCTGGAGCTCCACCGTTNNTGGCGGCCGCTCTAGAACTAGCGN
NNNNGNGNNGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG
CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCG
GCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCAC
ATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGG
CAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCA
AGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAG
AAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCA
GAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACC
CCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTTCGTGACCCGCCGCCGGGATCACTCACGGCATGGACGAGCTGT
ACAAGTAAGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATAACCGTTCGACCTCGAGGGGGGGGGCCCNG
GTACCCAATTTCGCCCTATNGTGAGTCGGTATTTANAATTTCACNTGGGCCGTTCGTTTTTACAAACGGTCGGTNGANCT
GGGGAAAAACCCTTGGNGGNTTACCCAAACTATANTCGGCCTTTGNNAGCAACAATCCCCCCTTTTCGGTCAAGGCTGGN
CGGTAATANNNNNAAAAGAAGGGCCCGGCAACGGGATTCGGCCCCTTTTCCCTAACAGGTTNNGCNGCCAAGCCCTGNNA
ATTGGGNCGAAATTGGGGGNNNNNNCGGNCCCCTTGNNNANNNNNGNGNCCGGCNNNNTTANNANNGGCNNCCNGNNNNN
NGGGNNTGGGNNGTGGNNNNNGNNN

>14E
NNNNNNNNNNATTTANCCCTNNCTAAAGGGAACAAAAGCTGGAGCTCCACCGTCGGTGGCGGCCGCTCTAGAACTAGNNG
NNCCCCCGGGCTGCAGGAATTCGATATCAAGCTTACCGACCCCGAGGGTAAAGATGATGAAGAAAACGGGTACCAGGTAA
CCGGCAATAAAGTCGTTTTCATAAGGTGTGCACAACAGAAGTAGCAGCACGCTTAACGCTGCCAGCCAGCTTAAGGTAAA
TGCGCGTTTCTCTTTGCCCAACGACGGAGCGATATCCCTGCGCCACAATATCTGCGCAAAGTGGGGACTTACAATCATGC
GAGTGAGATAGTAGAAAAGCATGTTGTAAATCAGCACAGCGGTGAAAAGGCTTAGCAAATCAACGACCGTGAAAATGGCA
TCCGCATCGCCGAAAAAGGTGGATATCTTTAGCGGGAAATCAAAGAAGCTCCCCACAAGATACATGCTGCATTTGATGCC
GATCGGCGTCACCAAACCAAGCCAGAACAGACGTTGCCAGACATATCGGCTGGTCAATCCATAACGCCAACGCGTCCCCA
GCTGCCAGCGTAATATTGCGCAGGCACACAACACGACAAACGTCTGGCTACCGAGCATGACCGCAGTCTGTAAAAAAGAG
AGATGAAAGTTCCACAGATTGGTGCAAAACATCCCGCATAAAACGGGAACGACACCGCGCCAGCCAAAGATAAACAAGAT
TGACAGCATTACGCACAGTGGCATCCACGCCAGAAAGATATAACTGGAATGGATAATGGCAAGTGGCGAAATAAAACGGG
ATAGCTGAATAAGTACCACGGTGAGCGTAAACGCTAGTGTGAATATCTTGATATTTTTTTATCAGGTTATGCTCCACAAA
CATGAGTACACTACTCTCACTGATCGGGGTTTTCAGGCACACAAATAATAAGTTTATTCGCATCGCGAAGCAAACAGGGG
GGCCAGCCTGTTGCCGATTTTTTCATNCANTGATGNTTTCACCANGNNGGCACTAACCCGGNCGTAGACTNNNTTACAAA
AAGCNGNNAAAAGNANANNNNAAAAACCCCCNNNTNCANCGAGNNNNNNNNNNGNNGANCTNANNNNNCNANCNCNNANC
NNNNTNNNANNNCCNNNNNNANNNGNNNN

>14G
NNNNNNNNNNNNNNNNCNNNNNNAAAGGGAANAAAAGCTGGAGNNCCACCNTNNNNGGCGGCCGCTCTAGAACTANNNNN
NNNNNNNNNNNNNGAGCAAGGGNNAGGAGNNNNCNNCNNNNNNNNNNGNCNATCCNGGNN

>15E
NNNNNNNNNANNNNCCNCACTAAAGGGANCAAAAGCTGGAGCTCCACCGNNGGTGGCGGCCGCTCTAGAACTAGTNGNNC
CCCCGGGCTGCAGGAATTCGATATCAAGCTTTATTGAAGGTAACGGATGTTCTAGTTTTATCTCTTTTAAGTTAAGAAAG
TCACGGTAGGAATTATAAAGTTCATAGGGGACTATTCCCAGTAAATCTGTAACTGNAATGCTATTAATGATTGTCAGCAA
AGAGGAACCACGAAATGAGATTTTGCGATTCATAAATCTCTCGTCTATTTCCATTTGAATATCATCAACCCCTGCTGATT
TAGATATTAATTGGGTGAACTCTTCTGCCATAATTTGTTCATAAGTGCTATTGTCAGTAATTCGTGGATGCCTATTACTA
CAAATTAGAGTATTGCGAATCGTATGCAATGGCATGCAAATGACGGAACGGCTGATCACTGGCATTTGGGTGATCACCAG
ATCGGCTTTGCGGTGAACCAACAGTTCTTCAGCATTCTCTGCTGACATGAGGATATCATGGCACTCAATCTCGACAGAGG
AATCTTGCCGTAGGCAGCGGATCAGCATACTATTATTAGAGCAAGAAATGAGCTGAGGGCCGTAGATAATAAAGTTTTTC
TTTAGTTCGGACTTATTGACTATATTAATTGTTTGTTCAAGGCCTCTGAGATTTTTCTCAAGATGGTGATGCAGATTTAA
CCCTGTTGTCGTCGGCGCGATACCTTTTCCTGAGCGAATGAATAAAGGGTCATTAAATTGCGCACGTAAGCGTTGTAACG
ACTGGCTCACGGCTGATGGGGTGATATATAGTGATTCAGCAGCTTTGCTAATGCTTAAATGCTGGTAAATACACTCAAAT
ATGACAAGAAGATTTAAGTCNGAACTTTTTCAAGTCGNAGAGATTGGNCATACACTACTCCGGGTTATATTTTTCTTCCA
TGATATATTNCACTTTAATCAATGGTTTTTTGCGGTATATATTTTTTATTGGATTATGGTTTTTTTTGCTTAACTCNNNA
TTAANNNTTTTTNCTAAAATAGGNNCAGGCCACTTAGGGNNANNNNNNNNNNNATNANGGNNTTTTAGGNANGGNNNANN
NNNGGNNNNTNNNNCANNNNNCCNNNNNAATTNNCCNTTNNNNNNNNNCCCCCNN

>15G
NNNNNNNNANNTNNNNNNNNCNNNAANNGGGAACNAAAGCTGGAGCTCCNNNGNNNGGCGGCCGCTCTAGAANANNNNNN
CNNNNCGTGNGNTNGNNAGAGCTGNNNCNNNCNNNGGGNCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACANG
NTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACTGTAAGCTGACCCTGAAGTTCATCTGCACCACCTGCAAGCT
GCCCGTGCCCTGTCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGTTTCAGCCGCTACCCCGACCACATGAAGC
AGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTTNTGGAGCGCACCATCTTCTTCAAGGACTACTGTNATTAN
TAGANCTGCGTCGAGNTGAAGTTCGAGGGNNACACCCTGGNGAACCGCATCGAGCTGAAGGNCATCGACTTTATGGAGGA
CGGCACCATCCTGGGGCACAAGCTGGAGAACAACTACACCAGCCACAACGTCNATNTNATGGCCGACAAGCACAANA

>16E
NNNNN

>16G
NNNNN

>17E
NNNNNNNNNANTTNANCCCTTCACTNNNGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTNNNNN
TNNNCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATATCACTCATGGTGAAGTCGATTTCCGCTTCCTGCGCCG
CCGCCAGCAGGTGAAGTACGGTGTTAGTCGATCCACCCATCGCGATATCCAGCGTCATGGCGTTTTCAAACGCCGCCTTA
CTGGCGATATTACGCGGCAGTGCACTTTCGTCGTTTTGCTCGTAATAACGTTTGGTCAATTCAACAATGCGTTTACCAGC
ATTAAGGAACAGCTGCTTACGGTCGGCGTGGGTTGCCAGCAGCGAGCCGTTGCCCGGCTGCGACAGGCCCAGCGCTTCGG
TCAGGCAGTTCATTGAGTTAGCGGTAAACATCCCGGAGCAGGAACCGCAGGTCGGACACGCGGAACGTTCAACCTGATCG
CTCTGGGAGTCAGATACTTTCGGGTCTGCGCCCTGGATCATCGCATCAACCAGATCGAGCTTGATGATCTGATCGGAAAG
TTTGGTTTTCCCGGCCTCCATCGGGCCGCCGGAAACAAAGATCACCGGAATATTCAGGCGCAGGGAAGCCATCAGCATCC
CCGGGGTGATTTTGTCGCAGTTAGAGATGCAGACCATGGCGTCGGCGCAGTGGGCGTTGACCATATACTCAACGGAATCA
GCGATCAGTTCGCGAGATGGCAGTGAATAAAGCATCCCCCCGTGGCCCATGGCAATCCCATCATCCACCGCAATGGTGTT
GAACTCTTTGGCAACGCCGCCAGCCGCTTTCAATTTGTTCGGCGACCAGTTTACCGAGATCGCGCAGATGGACGTGACCC
GGNACAAATTGGGGTGAACGAGTTNNNNACCGCGATAATCGGCTTACCCGAAAATCGGCGTCGGNCATTCCGGTGGCGCG
CCACAGCGCACGAGCNNCCCGCCATATTACCGACCATGAGTGGTGGGNGGCGGGAACGGGTACTTTAGGCAATACTTTTA
TTTTACTCCCCNNGNGNCNGTCNCGNAAAANGGGGNANGGGNGGNCGNNGNCCNGNCCCCNTTTTTTTNNNTTTNTNGGN
ANTAANNTNNNNNNNNNNNNNCCCCNATTTNNTNNNNNGNNNTNCNCCCNNNNNNNNNNNNNNN

>17G
NNNNN

>18E
NNNNNNNNNNNNNNNNNCCNNNCTNNNGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTNGN
NCCCCCGGGCTGCAGGAATTCGATATCAAGCTTTCTCTGCTGTGGCATTCGAGCGATATATTTTACCGACGCCATGCCAG
CATAACGAGCCAGATTACGCAGTTGAATGGCAGGCAGACCGGAAAAGTTCAGTCGGGAAAACTCAAGACTTCGTAATCGG
ATATATCGTTCCAGCGCTTCATTAAACGCAGGTCCACTGACTGTAACAGGGCCTTTTTTCAACTGTTCCAGTGCTGATAC
ACGCTGACCTTCCGGAATGACCAGAAGCTCCATCACTTGAGCTGCCTGCCATTTGTTCGGCAGTGCGGCCAGCTTTTTCC
ACAGCCGCTGATTTGCCCTTTCACGAATTTCACTGATGAGACGTACTAGTGTGGTTGCTCCGGGCAGTAATACCTTATTT
TGAAGCAACCATGCAGTGGCAAAATCAAACATCAGACCCGGTCGCTCATTACTGAGCCACGCCCGGGTATATAGCAGACG
CTTCAGGCGGAAAGACCATGGAAAATCACCAAATTCATGATAGCCGTAATATTCCTTAATTAATGCAGTATGTTCTCTAA
GGGTAGTGTCCCGTTCAGCATAGCGGGAGAGAACTTCTGGACGGTGGATATTAAGCTGTACCGCGACAAAATGTTGAACA
CCAGGCAGAACCTGAGTTAAATCCGTCAGAAATGTTCCCAGAAAACGGGCTGTGGTGAGCTGAAGCGCAATGCCCAGCCT
ATTATGTTTGCCCCGTCGTTGGTTAATGAAGGCCAGATCCCGTTCATCAAGATGAAAATAGCGCGCCAGTTGCACGTCAT
TAGGTTCTGCAGCATAACAACCGTAATTCTGTTTTTGGTCAGAGGTTAGAAAGTCGACAGGCATATCNGGCTCCCTACCT
GACAGTTATTCATTAACAATTTTGCAACCGTCCGAAATATTATAATTATCGCACACATAAAAANAGNGCTGTTAATGTGT
CNNATTAAANTNGATTTTTTTGTNATNACNNNNNCNGCTNGNNNNANNTTTGNNTTNNNNACNTTTTNNTGNNNNNTTTN
NNNNCNCNNNGNNNTNNANNCNANNNNNNNNANNNNNNCNNNNGAAATNNNN

>18G
NNNNNNNNNNNNNNNNCNTNNNNNAAGGNANNNAAAGCTGGAGCTCCNCCGTTNGNGGCGGCCGCTCTAGANNTNNNNNN
NATCNNGTGAGCAAGGGNGAGGAGCTGTNCACCNCNNNNGGGGCCCATCTNGAGGGAGGTGGACGGAGACGTAAACGGCC
ACAAGGTCACCGAGTACGGGGAGGGAGAGGGCGACGCCACCTACCGCAAGGTGAGCCTGAAGTCCGTCTGCACCACCGGC
AAGCTGCCCGNGCCCTGTCCCACCCTCGTGACCNCCTTCACCTACGGAGNGCAGTGCTTCAGNCGCTACCCCGACCNCAT
GAAGCANCCGACTTCTTCAAGGCACCCATGCCGGAAGGGTACATTCAGCAGCGCGCCATCTTCTTCTANGACGACGGTGN
CCGTTAACCCGCGACGAGGCGAAGTTCGAGGGCTACACGCTTGGTGAACCGCATCGAGCTGAAGGGCATCCGGTTTNACG
AGGACAGCTCCATCCTGGGGGATAAGTTGAAGGACAACNNCAANNNNCACAACGGCTATATCATGGCCGACAAGTTGAAG
AACGGGATCANGGNGAACTTCANGATCCNCCACAGAATCGAGNTTGGCAGCGTGTTATCTCGCCGATTACTACCAGTATA
ACACCGCCATCGGGNACGGCCCCGGGATGATGCTCAACAACATCTACCTGAAACCCTGTACNCCTGAGCAATACCCCGAT
GAGAAGCGAGAGCTTATTGNNTTGNTTNANTTCTNGACCGTCGACNGGATATTCACGGAATGGATAAGNGGTACAAGTAA
GGATCCCCCTGGTTTGCAGGAAATTTGATATCAAGTTTATAGATGTCGGTGAACCTCAAAGNNN

>19E
NNNNNNAATNNNNCNNNCACTAAAAGGGAACAAAAGCTGGAGCTCCACCGTTGGTGGCGGCCGCTCTAGAACNNNNNNNN
NCCCCGGGCTGCAGGAATTCGATATCAAGCTTGCAGTGATGATGTTTCACTACCCACTGCACGTGTCTCAGGATGCATAT
TCTTTGCGGTGTTATTTGCACTACATGCAGAAAGCAGAACCGCTACTGCAATCGCGGGAATCCCGCGCAAGATATATCTC
AAAATCGGTTGAGATTTGACCATGTTGTTTGTTTTCCCTTGAAGTCCTTAACGACAAATATCGTTATAAAAAAATGCCAA
GCGACACGAGACTAATTACCTGGGCATGTTGAAACAATTCCTTAAGGCCAAATCTGTGGACTAACGCACAAAATTATATG
CTGTGAGGATAATCTACCGCCGAGGCAAAACGAGTTCGAGATTACCCGATTGGTGCGGTCTTGGCGAGCGGTTTTACATG
ATTTTTTATAAGAAAAAGTGATACAGAAAGTTAATAAGCGGGGTTGGTCAATTAAAGTACAATTGAGTGAAACGCATGCA
ATCCATTCATTTACTTAGAGAATGATTTTTGCGTTCGATAGATGAAAGCACGGTGCGCATCATCAGGATTATCCTCACTA
TAAAAATAACCCTGATGATGTTAATTACTGTGAGTTATTTGTTTTGGAAATGTTTGTTTTTTCCTGGTAGTGATTTGTCA
AAAAAGGTGATTAATCGATCACTTAAATGGGCGTCAGCAACACCCAGGGCAAACCGATCAAATATCACGGTCATCGAACC
GACAATGATGTCAGTAAACCCAGTGTGCGCCAAATCATTACTCTGGGAAAATGCATAAAACCACAAAAATAATAAAGGGC
GATAAGGGCCTGCAACTTTTGCCCAAAATAACGCCA

>19G
NNNNNNNNNNNNNCCNNTNCNNTAAAANNNNAANNAANGCTTGGAGCTCCACCNTTTNGTGGCGGCCGCTCTAGAACTAG
NNNNANNNGGGGNAGTGAGCAAGGGCGAGGAGCTGTTCACCGNNNGNGGNGCCCATCCTGGTCGAGCTGGACGGCGACGT
AAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCA
CCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCC
GACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGA
CGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCG
ACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGAC
AAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTA
CCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGNCCTGAGCA
AAGACCCCAACGAGAAGCGCGATCACATGGTCCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGA
GCTGTACAAGTAAGGATCCCCCGGGCTGCAGGAATTCGATATCAAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCC
CGGTACCCAATTTCGCCCTATAAGTGAGTCGNATTTACAATTCACTGGGCCGTCGTTTTACAACGNCGTGACCTGGGNAA
AAACCCTGNCGTTAACCCAACTTTAATCCGCCCTTTGCAGCACATCCCCCCTTTTCGNCNAGCCTGGNNCGTAATAANCN
NAANGAGGNCCGCACCNAATCGGCCCTTTNCCCAACNNNNTTGCNNCCNANCCNNNNAATNNGNCNAANNNGGNANNGNN
NNCNNNNANNNNNGGNNNNNNNTTAAGNNNCNGNNNNGGNNNNNNNNNNNNANNNCGACNANNNNNGNNNNNCCGNNNNT
NNNNNNNNNNNNNNNNNNNNNNGNGNGN

>20E
NNNNNTNNNNNNNCCNTTNNNNNNNNGNNACNNAAGCTGGAGCTCCACCGNGGNGGCGGCCGCTCTAGAACTNGNGGNTC
CCCCGGGCTGCAGGAATTCGATATCAAGCTTTTATTGAAGAAGTGGTACCGCACGAACTGGCACATTTGCTGGTATGGAA
ACATTTCGGCCGCGTAGCGCCACATGGCAAAGAGTGGAAGTGGATGATGGAAAACGTGCTGGGTGTTCCCGCCCGTCGTA
CGCATCAGTTCGAACTGCAATCCGTGCGTCGCAACACCTTCCCCTACCGCTGCAAGTGCCAGGAGCATCAGCTTACCGTA
CGCCGCCATAATCGCGTAGTTCGTGGCGAGGCCGTCTATCGCTGTGTTCACTGCGGTGAACAGCTGGTTGCGAAATAACC
ATCTGAACTATCAGGAACTTTCCTGATCTGGCTGATTGCATACCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAAC
ACGGAGTAAGTGATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGCCCGGCGTTGGCCGA
AGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGAT
GTAAAATTAACTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAAATGAAAACCG
CGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCGCCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGAC
GTAAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGGAAAGCGATATGCATAACCTTGCAGCCGTCAGNCGGTGAG
GTGAATGGCGATCGCGGGCNACCTTTNTGTACAGNCCAGTGNAATGGCGGTNGAAGGCCAGTACTGGTCAATGCGCCCTG
AAGGTCGATTTCCAANGAAAAAGCTGGCCNAACCCACCNNNCGCCGTGCANCGCNGTTGCCAATTGCGCNGNCANCTTAC
TTTCTNANATGGCGCGANCCAATAACNANCNTGANCNNCTCNNNNNNNNCCANNNNAAANNNNNANNNGNTNNANNNNNN
GGNNNNNANGANANGNTNNTTCNCNNNGTTNTNCNCGCGNNNCCTGNGNNNANNNNNNN

>20G
NNNNNNNNAANTTANCCNNNNNNNNNNNNAACNNNNGNTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTANNNTNN
CCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCA
CAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA
AGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATG
AAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAA
CTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGG
AGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAG
AACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAA
CACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCA
ACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAG
TAAGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGTACCAATT
CGCCCTATAGTGAGTTCGTATTACAATTCACTGGGNCGTCGTTTTACAACGTCGNGACTGGGGAAAANCCTNNCGTTNAC
CCAAACTTAATTCGCCTTGCAGCACATCCCCCTTTTCGCNAGCTGGCGTAAATTAGCGAANANGNNNGCNNCCGAATCGC
CCNTTCCCNACANNTNGCNCANNNNNNAATGGNNGAAANNGGGNANNNNNNNNCCNNNNNNNNNNNNNTTNANNNNNNNN
NNGGNNGTTNNCNNNCAANNNNNGANCNNNNNNCCNNNTNNNNNNNNNNNNN

>21E
NNNNNNNNNNNCCTCACTAAAGGNNNNNAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCG
GGCTGCAGGAATTCGATATCAAGCTTCCTGAATCAAGGGCAAGTATGCGCCGCCAGTTCGCGAATTTATATTGAAGCGCC
GTTGTTTGACACGCTGGTTAGTGGATTTGAGCAGGCGGTAAAATCGTTGCAAGTGGGACCGGGGATGTCACCTGTTGCAC
AGATTAACCCTTTGGTTTCTCGTGCGCACTGCGACAAAGTGTGTTCATTCCTCGACGATGCGCAGGCACAGCAAGCAGAG
CTGATTCGCGGGTCGAATGGACCAGCCGGAGAGGGGTATTATGTTGCGCCAACGCTGGTGGTAAATCCCGATGCTAAATT
GCGCTTAACTCGTGAAGAGGTGTTTGGTCCGGTGGTAAACCTGGTGCGAGTAGCGGATGGAGAAGAGGCGTTACAACTGG
CAAACGACACGGAATATGGCTTAACTGCCAGTGTCTGGACGCAAAATCTCTCCCAGGCTCTGGAATATAGCGATCGCTTA
CAGGCAGGGACGGTGTGGGTAAACAGCCATACCTTAATTGACGCTAACTTACCGTTTGGTGGGATGAAGCAGTCAGGAAC
GGGCCGTGATTTTGGCCCCGACTGGCTGGACGGTTGGTGTGAAACTAAGTCGGTGTGTGTACGGTATTAATCTGGTTCGC
TCATAAGTAAAAAACGGCACNTGGNGNNTTTTTTGTGTGAGACACTCTCTNNTCTCTCTTTTNNGCCCCTATAGTTGNGG
TGTCTCCAAAAAGAAGCTATGTGTTCAGNNNAGAATGTGCNCNTNCTNNNNNNNNTATNCGGNNACTCTNTNNNGCGNGG
NCACATGTGTGNGGNGNNGNGNTNNNNNANNACGANNANCGGGNGNCTGTGNAGNNNCNTCGACNNNNCTNANCTGTANT
GTNCTAGNACCAGNAGNNNNTGANNNNNNNNNNCGGGATANNNNGNCNTTTNCCCGNNNNGCNNNNNNCNNNNNNNAGNN
NCNANNANNNNCNNNNNANNCCNNNNNNNNNNNNNNCNNNNNTNNNNNNNNNANCNGANNNNNNNCNCNACGNNNGNNGN
CNNNNNNCNNNNNNNNNNNNNNNATNNNNNANNNNNNNNNNCNNNNNNNCNNNNNNNNNNNN

>21G
NNNNNNNNNNNNNNNNNCNNNNNNGGGNNCNNAAGCTGGAGCTCCNCCGTNGTGGCGGCCGCTCTAGAACTAGANNNNNN
NCNNGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGNGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACA
AGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAG
CTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAA
GCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACT
ACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG
GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAA
CGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACA
CCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAAC
GAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTA
AGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGNACCCAATTC
GCCCTATAGTGAGTCGTATTACAATTTCACTGGNCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTTGGCGNTAACCC
AACTTTAATCGCCTTGCAGCACATCCTCNCCTTTTCGNCCAGCTGGNGTAATNNGCGNAAGAAGGGCCCGGCNCCGGATC
GGCCCTTTCCCAAACAGTTTGCNCCAGCCCTGAANNGGNNGAAATGGGACNNNNCCNNNNANNGGGNNGNNNTTTAANNN
NNNNNNNNGNNNGNNNGNTTTANCNNGNNNNNNNNNNNACNGNNNNNNANNNCNNNNNNNNNNCNNNNNNNNNN

>22E
NNNNNNANNNTNNNNNCNCTAAAGNNNNNNAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTNGTNGNNCCCC
CGGGCTGCAGGAATTCGATATCAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTTTTGCCCG
TCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTTTCTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCT
TCATGGCGGCAGCAAGTTCAGAGGCAGGAACAACCTGTTCTCCGGCGGCGACAGCAGTAAGACTTCCTTCCTGGTATTGC
TTACGCCAGAGAAATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCATCCCCGGTTCAAAGCT
CTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGCGTTTCTCCGGCCCTAAGACATCAATCATCTGTTCTC
CAATGACTAGTCTAAAAACTAGTATTAAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGT
CTAAACCCCAGAACTTACTTATGCTGATTCCGGTGCGAAAATTGTTAATAAAGGTACTTGTAGATTCAATTGGTCAACGC
AACAGTTATGTGAAAACATGGGGTTGCGGAGGTTTTTTGAATGAGACGAACATTTACAGCAGAGGAAAAAGCCTCTGTTT
TTGAACTATGGAAGAACGGAACAGGCTTCAGTGAAATAGCGAATATCCTGGGTTCAAAACCCGGAACGATCTTCACTATG
TTAAGGGATACTGGCGGCATAAAACCCCATGAGCGTAAGCGGGCTGTAGCTCACCTGACACTGTCTGAGCGCGAGGAGAT
ACGAGCTGGTTTGTCAGCCAAAATGAGCATTCGTGCGATAGCTACTGCGCTGAATCGCAGTCCTTCGACGATCTCACGTG
AAGTTCAGCGTAANCGGGGCAGANGCTATTACAAAGCTGNTNGATGCTAATAACNGANCCAACNGAANGGNNAAAANGNC
AAAANNNGCTTNACNNGGNTCAAAATTNNCNNTNGCNNNNNTNNNCNNNNNNNNCNANNNCNNNNNNNNCNNNNCNNNNN
NNNCCCCNNNNNNNNANNNNGNNNN

>22G
NNNNNNNNNANNTANNNNNCNNNNAAGGGANCAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGAT
CCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCA
CAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA
AGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATG
AAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAA
CTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGG
AGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAG
AACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAA
CACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCA
ACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAG
TAAGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGTACCCAAT
TCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGNNTTACCCA
ACTTAAATCGCCNTTGCAGCACATCCCCCTTTCGCCAGCTNGNGTANAGCGAAGANNCCGCACCGATCNNNNTNNNNNNN
NNCGCANNNNANNNNNNNGNNNGNNNNNNNAGCGNNNATNNNNNNNNNNNNNGNNNNCNNNCANNNNNNNNNNNNNCNNN

>23E
NNNNNTNNNNNTTNNNNNNCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGNT
CCCCCGGGCTGCAGGAATTCGATATCAAGCTTGCAGTGATGATGTTTCACTACCCACTGCACGTGTCTCAGGATGCATAT
TCTTTGCGGTGTTATTTGCACTACATGCAGAAAGCAGAACCGCTACTGCAATCGCGGGAATCCCGCGCAAGATATATCTC
AAAATCGGTTGAGATTTGACCATGTTGTTTGTTTTCCCTTGAAGTCCTTAACGACAAATATCGTTATAAAAAAATGCCAA
GCGACACGAGACTAATTACCTGGGCATGTTGAAACAATTCCTTAAGGCCAAATCTGTGGACTAACGCACAAAATTATATG
CTGTGAGGATAATCTACCGCCGAGGCAAAACGAGTTCGAGATTACCCGATTGGTGCGGTCTTGGCGAGCGGTTTTACATG
ATTTTTTATAAGAAAAAGTGATACAGAAAGTTAATAAGCGGGGTTGGTCAATTAAAGTACAATTGAGTGAAACGCATGCA
ATCCATTCATTTACTTAGAGAATGATTTTTGCGTTCGATAGATGAAAGCACGGTGCGCATCATCAGGATTATCCTCACTA
TAAAAATAACCCTGATGATGTTAATTACTGTGAGTTATTTGTTTTGGAAATGTTTGTTTTTTCCTGGTAGTGATTTGTCA
AAAAAGGTGATTAATCGATCACTTAATGGCGTCAGCAACACCCAGGGCAAACCGATCAATATCACGGTCATCGAACCGAC
AATGATGTCAGTAAACCAGTGTGCGCCAATCATTACTCTGGGAAATGCAAAAACCACAAAAATAATAAGGGCGATAAGGC
CTGCAACTTTGCCGAAATAACGCCACATGAATGCCGAAAAAATAAGCAGCATCATGCCGTGATCGCCGGGAAAGNTATCT
CGTGAGGCATCTTTCGTGGNACAGANAGNCAGTTCGCTGACNNCGGTNAATATCGNNAAAAGTCAATGNTNGGGNTGGNC
CGTTTNCNNGNTTNAANNCNTGNNCCNNNNNNTTAATNCNNCTGCANNTTAATANCNATNNNCNNANNNNNNNCACGATN
CNNCNNNNNNNNNGGGGGNNNTTTTCCTTNNNN

>23G
NNNNNNNNNNACCNTCACTAAAGGNNNNNAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTNGTGGATCCTCG
AGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGT
TCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTG
CCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA
GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACA
AGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGAC
GGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGG
CATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCC
CCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAG
AAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTAAGG
ATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGGCCCGGTACCCAATTCGCC
CTATAGNGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTA
AATCGCCTTGCAGCACATCCCCCNTTTCGCCAGCTGGCGTAATAGCGAANNANGNCCGCACCNNATCGCCCCTTCCNNCA
NNNGCNCANNNNNAATGGNNAATNNNNGNCNCCCNNNNNGNNGNCGCATTAANNNNNNNNNNNNNNNNNNCGNNCNNGNN
GNGAACCNNNNNNNNNNNNNN

>24E
NNNNNNNNNNNNNNNNNNNNNNNCACTAAAAGGGAANAAAAGCTGGAGCTCCACCNNNNGTGGCGGCCGCTCTAGAANNG
NNNNGNNCCCNGGCTGCAGGAATTCGATATCAAGCTTATCANGGGTATAAAATTATCCATCTCATCAATAATGCCTTTTG
TATAGCCATCATAATAACCTTGAATAAATTTTTCTTCTCTCTTTTCCTCAATACTCTGAATTTTTGCGGTGGTTTCAAGA
AGGATTTTTTCTTTAAGAGAAACTATTTCTTTCAATCCATCAGAAATTTTTCTTTTAATCACAACACCATTTGCAGGAGA
TTTTATCAAGCTCATCTCTATTTTTTTTCGCATAAAATGTAATTCTCTCTAAAAGTGTTGATGCAAGTGGTAACGGCGAT
TGTATGTGGTCAACAAAATCAGGAAATAATAAATTAAATCGTTGCTGCATTGCCAATGGTTGTTGCCTTATATAGGGTAA
CAACGTTGAAAAACCACATGTGATGATATTGTGATAGTTAGCGATGCCGGGTTTGTATCGTGCCTTTTCATTTATTTCCA
GCGGTATAGCTGATAAATAATCCCTTAGTACATCAGGAACCTTATNAAAAAACCCGCGTTCTGCAAACCTTTCTCGATAA
AAGTGACAACCACTGAGTAAACAGATCAATGGAAGTANNTTCCAATTGTTTATTGGATTTGCCCCTATATTTCCAGACAT
CTGTTATCACTTAACCCATTTACAAGCCCGCTGCCGCANATATTCCCGTGGCGAGCGATAACCCANCGCACTATGCGGAT
GCCATTCGTTATAATGCTCNAACGCCTCTGCAAGGNTCTTTGCTGCCGTTAACCCGNCTGGTTTGGGCATGATACTGATG
TAGTCACGCTTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCCGGANTTCCGCACCGCCGTGGTTCTTCG
GTTCAAGTCCCAACATCCGGGGCGAACTGGNCGTGTTTCATTAANCCCGGGTAGCATTGAACCCATTTATTCCGTNCGCC
CACCTCCACTGGGANAANNANNGNAANGAANNGTTTGCCCGAAGCNGGCCGNTTCNCACCCGNTNCCCCAG

>24G
NNNNNNNNNNNNNNNCCNTNNNNNNNNGNNANNANGCTGGAGCTCCACCGTTGGTGGCGGCCGCTCTAGAACTACNNNGN
NNCTCGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCC
ACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGC
AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACAT
GAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCA
ACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG
GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAA
GAACGGCATCAAGGTGAANTTCAAGATCCGCCACAACATCGAGGACGGCAGCGNGCANCTCGCCGACCACTACCAGCAGA
ACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCACTCCGCCCTGAGCAAAGACCCC
AACGAGAAGCGCGATCACATGGTCCTGCCTGGAGTTCGTGACCGNCCGCCGGGATCCACTCACGGGCATGGACGAGCTGT
ACAAGTAANNATTNCCCCNTNGTGNNTGAATTTCGACATCAAGCTTATCNATACCGTTCAACCTCGTAGGGGGGGN